Product Details

SNP ID

rs139131485

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.8:132572316 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACGCAGCCAGATGTTTCAAATCAGC[A/G]GAGGCACTTCAGGGTTGTCTTCAAA

Phenotype

MIM: 614930

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

LRRC6 PubMed Links

Additional Information

For this assay, SNP(s) [rs9297853] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

LRRC6

Gene Name

leucine rich repeat containing 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321961.1	2148	Missense Mutation	CCG,CTG	P444L	NP_001308890.1
NM_001321962.1	2148	Missense Mutation	CCG,CTG	P382L	NP_001308891.1
NM_001321963.1	2148	Missense Mutation	CCG,CTG	P344L	NP_001308892.1
NM_001321964.1	2148	Missense Mutation	CCG,CTG	P344L	NP_001308893.1
NM_001321965.1	2148	Missense Mutation	CCG,CTG	P344L	NP_001308894.1
NM_001321966.1	2148	Missense Mutation	CCG,CTG	P324L	NP_001308895.1
NM_012472.5	2148	Missense Mutation	CCG,CTG	P464L	NP_036604.2
XM_006716538.3	2148	Missense Mutation	CCG,CTG	P470L	XP_006716601.2
XM_011516950.2	2148	Missense Mutation	CCG,CTG	P450L	XP_011515252.1
XM_017013296.1	2148	Missense Mutation	CCG,CTG	P430L	XP_016868785.1
XM_017013297.1	2148	Missense Mutation	CCG,CTG	P344L	XP_016868786.1
XM_017013298.1	2148	Missense Mutation	CCG,CTG	P344L	XP_016868787.1

View Full Product Details