Product Details

SNP ID: rs145654005
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:79765212 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTAAAAAGCTCCGATCTCCGTCCC[A/C]CAAGGTCTATAGGGCTTGCCAAGGT
Phenotype: MIM: 602953
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: HEY1 PubMed Links

Gene Details

Gene: HEY1
Gene Name: hes related family bHLH transcription factor with YRPW motif 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040708.1	833	Missense Mutation	TGG,TGT	W301C	NP_001035798.1
NM_001282851.1	833	Missense Mutation	TGG,TGT	W207C	NP_001269780.1
NM_012258.3	833	Missense Mutation	TGG,TGT	W297C	NP_036390.3

Gene: LINC01607
Gene Name: long intergenic non-protein coding RNA 1607

There are no transcripts associated with this gene.

Gene: LOC101927040
Gene Name: uncharacterized LOC101927040

There are no transcripts associated with this gene.

View Full Product Details