Product Details

SNP ID: rs145988500
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:22600944 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTGGAGTCACCAGCACCTACAGA[C/G]GGATCCCCGACGCTGCCCACGGGTG
Phenotype: MIM: 607359 MIM: 609722
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C8orf58 PubMed Links

Gene Details

Gene: C8orf58
Gene Name: chromosome 8 open reading frame 58

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013842.2	223	Missense Mutation	CGG,GGG	R35G	NP_001013864.1
NM_001198827.1	223	Missense Mutation	CGG,GGG	R35G	NP_001185756.1
NM_173686.2	223	Missense Mutation	CGG,GGG	R35G	NP_775957.2

Gene: CCAR2
Gene Name: cell cycle and apoptosis regulator 2

There are no transcripts associated with this gene.

Gene: LOC107986876
Gene Name: proline-rich proteoglycan 2-like

There are no transcripts associated with this gene.

Gene: PDLIM2
Gene Name: PDZ and LIM domain 2

There are no transcripts associated with this gene.

View Full Product Details