Product Details

SNP ID: rs142704657
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:35660645 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCCCAGCTGGACCCCCTTTTTGA[G/T]CGGTGAGGAGAGCAATGATTCTGTG
Phenotype: MIM: 157660 MIM: 604964
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ARHGEF39 PubMed Links

Gene Details

Gene: ARHGEF39
Gene Name: Rho guanine nucleotide exchange factor 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032818.2	2109	UTR 3			NP_116207.2
XM_011518057.2	2109	UTR 3			XP_011516359.1
XM_017015225.1	2109	UTR 3			XP_016870714.1
XM_017015226.1	2109	Intron			XP_016870715.1
XM_017015227.1	2109	UTR 3			XP_016870716.1
XM_017015228.1	2109	Intron			XP_016870717.1

Gene: CCDC107
Gene Name: coiled-coil domain containing 107

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195200.1	2109	Missense Mutation	GAG,GAT	E136D	NP_001182129.1
NM_001195201.1	2109	Missense Mutation	GAG,GAT	E136D	NP_001182130.1
NM_001195217.1	2109	Missense Mutation	GAG,GAT	E136D	NP_001182146.1
NM_174923.2	2109	Missense Mutation	GAG,GAT	E136D	NP_777583.2
XM_005251403.4	2109	Missense Mutation	GAG,GAT	E136D	XP_005251460.1

Gene: RMRP
Gene Name: RNA component of mitochondrial RNA processing endoribonuclease

There are no transcripts associated with this gene.

Gene: SIT1
Gene Name: signaling threshold regulating transmembrane adaptor 1

There are no transcripts associated with this gene.

View Full Product Details