Product Details

SNP ID: rs143554180
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:136941288 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCTGCTGACGTCCAGGAAGATGA[A/T]GAAGCACTCGTCGTTGGGCGTGTAG
Phenotype: MIM: 120930 MIM: 609072 MIM: 612905
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: C8G PubMed Links

Gene Details

Gene: C8G
Gene Name: complement component 8, gamma polypeptide

There are no transcripts associated with this gene.

Gene: FBXW5
Gene Name: F-box and WD repeat domain containing 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018998.3	1600	Missense Mutation	ATC,TTC	I474F	NP_061871.1
XM_005266089.2	1600	Missense Mutation	ATC,TTC	I484F	XP_005266146.2
XM_011518789.1	1600	Missense Mutation	ATC,TTC	I466F	XP_011517091.1
XM_017014812.1	1600	Missense Mutation	ATC,TTC	I456F	XP_016870301.1

Gene: LCN12
Gene Name: lipocalin 12

There are no transcripts associated with this gene.

View Full Product Details