Product Details
- SNP ID
-
rs138166791
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.X:145994286 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAACTTGTACTTGGTAAGACTTACT[C/G]TACTCAGAAAGGGAATAGTTACATG
- Phenotype
-
- Polymorphism
- C/G, Transversion substitution
- Allele Nomenclature
-
- Literature Links
-
MIR888
PubMed Links
Gene Details
- Gene
- MIR888
- Gene Name
- microRNA 888
There are no transcripts associated with this gene.
- Gene
- MIR890
- Gene Name
- microRNA 890
There are no transcripts associated with this gene.
- Gene
- MIR891B
- Gene Name
- microRNA 891b
There are no transcripts associated with this gene.
- Gene
- MIR892A
- Gene Name
- microRNA 892a
There are no transcripts associated with this gene.
- Gene
- MIR892B
- Gene Name
- microRNA 892b
There are no transcripts associated with this gene.
- Gene
- MIR892C
- Gene Name
- microRNA 892c
There are no transcripts associated with this gene.
View Full Product Details