Product Details

SNP ID: rs7124179
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:791990 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGTAGACCACCTGTGCGATGCC[G/A]AAAAGGGGCGCGATGACCAGCGCGC
Phenotype: MIM: 608213 MIM: 605247 MIM: 609302
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: CEND1 PubMed Links

Gene Details

Gene: CEND1
Gene Name: cell cycle exit and neuronal differentiation 1

There are no transcripts associated with this gene.

Gene: LOC171391
Gene Name: uncharacterized LOC171391

There are no transcripts associated with this gene.

Gene: PANO1
Gene Name: proapoptotic nucleolar protein 1

There are no transcripts associated with this gene.

Gene: PIDD1
Gene Name: p53-induced death domain protein 1

There are no transcripts associated with this gene.

Gene: SLC25A22
Gene Name: solute carrier family 25 member 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001191060.1	1223	Silent Mutation	TTC,TTT	F299F	NP_001177989.1
NM_001191061.1	1223	Silent Mutation	TTC,TTT	F299F	NP_001177990.1
NM_024698.5	1223	Silent Mutation	TTC,TTT	F299F	NP_078974.1
XM_011520369.1	1223	Silent Mutation	TTC,TTT	F299F	XP_011518671.1
XM_011520370.1	1223	Silent Mutation	TTC,TTT	F299F	XP_011518672.1
XM_011520371.1	1223	Silent Mutation	TTC,TTT	F299F	XP_011518673.1

View Full Product Details