Product Details

SNP ID: rs186948400
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:49033209 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTCCCATAGCATCTCCTCAGTCAC[A/G]TGGCTGGGCAAGACATAGCCTAGGA
Phenotype: MIM: 146691 MIM: 612911
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IMPDH2 PubMed Links

Gene Details

Gene: IMPDH2
Gene Name: inosine monophosphate dehydrogenase 2

There are no transcripts associated with this gene.

Gene: NDUFAF3
Gene Name: NADH:ubiquinone oxidoreductase complex assembly factor 3

There are no transcripts associated with this gene.

Gene: QRICH1
Gene Name: glutamine rich 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320580.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307509.1
NM_001320581.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307510.1
NM_001320582.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307511.1
NM_001320583.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307512.1
NM_001320584.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307513.1
NM_001320585.1	2224	Silent Mutation	CAC,CAT	H602H	NP_001307514.1
NM_017730.3	2224	Silent Mutation	CAC,CAT	H602H	NP_060200.2
NM_198880.2	2224	Silent Mutation	CAC,CAT	H602H	NP_942581.1
XM_011533863.1	2224	Silent Mutation	CAC,CAT	H602H	XP_011532165.1

View Full Product Details