Product Details

SNP ID: rs191466012
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.10:103303936 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATCTTCAGAGGAGAAACCACAAGA[A/C]CATAATGAAGGACAAGCAGACCATC
Phenotype: MIM: 607816
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: PCGF6 PubMed Links
Additional Information: For this assay, SNP(s) [rs59709249] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001011663.1		Intron			NP_001011663.1
NM_032154.3		Intron			NP_115530.2