Product Details

SNP ID: rs191515346
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:126438412 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCAGGTTGATAGTGCTTCCTGGG[A/T]ACTGGGTGGCCTCCGGTCCAGCAGG
Phenotype: MIM: 615746
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: CFAP100 PubMed Links

Gene Details

Gene: CFAP100
Gene Name: cilia and flagella associated protein 100

There are no transcripts associated with this gene.

Gene: LOC105374089
Gene Name: uncharacterized LOC105374089

There are no transcripts associated with this gene.

Gene: ZXDC
Gene Name: ZXD family zinc finger C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001040653.3	2339	Intron			NP_001035743.1
NM_025112.4	2339	Missense Mutation	TAC,TTC	Y847F	NP_079388.3
XM_005247757.3	2339	Intron			XP_005247814.1
XM_006713741.2	2339	Missense Mutation	TAC,TTC	Y758F	XP_006713804.1
XM_011513119.2	2339	Missense Mutation	TAC,TTC	Y790F	XP_011511421.1

View Full Product Details