Product Details

SNP ID: rs191663634
Assay Type: Functionally tested
NCBI dbSNP Submissions: 19
Location: Chr.1:156293154 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCAGGGCCACTGCCATGATGCCCA[C/G]GACTAGTGGGGACAAGCCGTCCACT
Phenotype: MIM: 610962 MIM: 615531
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: GLMP PubMed Links

Gene Details

Gene: GLMP
Gene Name: glycosylated lysosomal membrane protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256604.1	814	Silent Mutation	CTG,GTG	L322V	NP_001243533.1
NM_001256605.1	814	Silent Mutation	CTG,GTG	L285V	NP_001243534.1
NM_001256608.1	814	Missense Mutation	CCT,CGT	P285R	NP_001243537.1
NM_001256609.1	814	Silent Mutation	CTG,GTG	L290V	NP_001243538.1
NM_144580.2	814	Silent Mutation	CTG,GTG	L371V	NP_653181.1
XM_011509117.2	814	Silent Mutation	CTG,GTG	L194V	XP_011507419.1
XM_017000149.1	814	UTR 3			XP_016855638.1

Gene: SMG5
Gene Name: SMG5, nonsense mediated mRNA decay factor

There are no transcripts associated with this gene.

Gene: TMEM79
Gene Name: transmembrane protein 79

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032323.2	814	Intron			NP_115699.1

Gene: VHLL
Gene Name: von Hippel-Lindau tumor suppressor like

There are no transcripts associated with this gene.

View Full Product Details