Product Details

SNP ID: rs7246510
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49684173 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CACAGACGGGACTTACTGTGGGGGC[G/T]TAGCTGCAAGGTGTTAGAAAGCCAC
Phenotype: MIM: 608846 MIM: 602950
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ADM5 PubMed Links

Gene Details

Gene: ADM5
Gene Name: adrenomedullin 5 (putative)

There are no transcripts associated with this gene.

Gene: CPT1C
Gene Name: carnitine palmitoyltransferase 1C

There are no transcripts associated with this gene.

Gene: MIR5088
Gene Name: microRNA 5088

There are no transcripts associated with this gene.

Gene: PRMT1
Gene Name: protein arginine methyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001207042.2		Intron			NP_001193971.1
NM_001536.5		Intron			NP_001527.3
NM_198318.4		Intron			NP_938074.2
XM_005258842.1		Intron			XP_005258899.1
XM_017026734.1		Intron			XP_016882223.1
XM_017026735.1		Intron			XP_016882224.1
XM_017026736.1		Intron			XP_016882225.1

View Full Product Details