Product Details

SNP ID: rs200871795
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6210057 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGGCAGGATCTGAGGGTGCCTTC[A/G]CCCACTGCACTCGGGAATACTCACC
Phenotype
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C11orf42 PubMed Links

Gene Details

Gene: C11orf42
Gene Name: chromosome 11 open reading frame 42

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_173525.2	328	Missense Mutation	ACC,GCC	T94A	NP_775796.2
XM_011519926.2	328	Missense Mutation	ACC,GCC	T94A	XP_011518228.1
XM_011519927.2	328	Missense Mutation	ACC,GCC	T94A	XP_011518229.1

Gene: FAM160A2
Gene Name: family with sequence similarity 160 member A2

There are no transcripts associated with this gene.

Gene: OR52W1
Gene Name: olfactory receptor family 52 subfamily W member 1

There are no transcripts associated with this gene.

View Full Product Details