Product Details

SNP ID: rs199630913
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:62666847 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATGGGATGCTGTTGCCCGGGGAGG[C/T]CTGCCTAGGGCTTACCAGCTTCTAT
Phenotype: MIM: 616378 MIM: 616097
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C11orf98 PubMed Links

Gene Details

Gene: C11orf98
Gene Name: chromosome 11 open reading frame 98

There are no transcripts associated with this gene.

Gene: LBHD1
Gene Name: LBH domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024099.3	1147	Intron			NP_077004.2

Gene: METTL12
Gene Name: methyltransferase like 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001043229.1	1147	Silent Mutation	GGC,GGT	G173G	NP_001036694.1
XM_005274232.4	1147	Silent Mutation	GGC,GGT	G296G	XP_005274289.1

Gene: SNORA57
Gene Name: small nucleolar RNA, H/ACA box 57

There are no transcripts associated with this gene.

Gene: UBXN1
Gene Name: UBX domain protein 1

There are no transcripts associated with this gene.

Gene: UQCC3
Gene Name: ubiquinol-cytochrome c reductase complex assembly factor 3

There are no transcripts associated with this gene.

View Full Product Details