Product Details

SNP ID: rs201936593
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:67492120 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGTGTTCCCGGGCCCTCACGCTC[C/T]GCCTGGCTGGGGCCCCTCGAGCGAA
Phenotype: MIM: 605555 MIM: 608794
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AIP PubMed Links

Gene Details

Gene: AIP
Gene Name: aryl hydrocarbon receptor interacting protein

There are no transcripts associated with this gene.

Gene: MIR6752
Gene Name: microRNA 6752

There are no transcripts associated with this gene.

Gene: PITPNM1
Gene Name: phosphatidylinositol transfer protein membrane associated 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130848.1	3890	Silent Mutation			NP_001124320.1
NM_004910.2	3890	Silent Mutation			NP_004901.2
XM_011545396.2	3890	Silent Mutation			XP_011543698.1
XM_017018586.1	3890	Silent Mutation			XP_016874075.1

View Full Product Details