Product Details

SNP ID: rs201410689
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:65896828 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTACCTGTTCACAAGGCCTTCGA[C/T]GTACCCCTGGAGGCGGCCCCAGGGC
Phenotype: MIM: 605360 MIM: 608296 MIM: 136515
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CCDC85B PubMed Links

Gene Details

Gene: CCDC85B
Gene Name: coiled-coil domain containing 85B

There are no transcripts associated with this gene.

Gene: FIBP
Gene Name: FGF1 intracellular binding protein

There are no transcripts associated with this gene.

Gene: FOSL1
Gene Name: FOS like 1, AP-1 transcription factor subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001300844.1	465	Missense Mutation			NP_001287773.1
NM_001300855.1	465	Missense Mutation			NP_001287784.1
NM_001300856.1	465	Intron			NP_001287785.1
NM_001300857.1	465	Intron			NP_001287786.1
NM_005438.4	465	Missense Mutation			NP_005429.1

View Full Product Details