Product Details

SNP ID: rs201162064
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64925862 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCCTCCGCAGAGCCCGGCCCCGCC[A/G]CTCCCACAGCTCCTCTCAGTTCCGC
Phenotype: MIM: 616225 MIM: 609651 MIM: 601644
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATG2A PubMed Links

Gene Details

Gene: ATG2A
Gene Name: autophagy related 2A

There are no transcripts associated with this gene.

Gene: GPHA2
Gene Name: glycoprotein hormone alpha 2

There are no transcripts associated with this gene.

Gene: PPP2R5B
Gene Name: protein phosphatase 2 regulatory subunit B'beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006244.3	183	Missense Mutation	CAC,CGC	H43R	NP_006235.1
XM_011545132.2	183	Missense Mutation	CAC,CGC	H14R	XP_011543434.1
XM_011545133.1	183	UTR 5			XP_011543435.1
XM_011545134.2	183	UTR 5			XP_011543436.1

View Full Product Details