Product Details

SNP ID: rs201115819
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:9068811 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTTACTGGGACATCTTGCAGAACC[A/G]TGAAGAACAAGCTCAGTGTCTGATT
Phenotype: MIM: 103950 MIM: 604874
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: A2M PubMed Links

Gene Details

Gene: A2M
Gene Name: alpha-2-macroglobulin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000014.4	4408	Missense Mutation	ACG,ATG	T1432M	NP_000005.2
XM_006719056.2	4408	Missense Mutation	ACG,ATG	T1432M	XP_006719119.1

Gene: A2M-AS1
Gene Name: A2M antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: KLRG1
Gene Name: killer cell lectin like receptor G1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005810.3	4408	Intron			NP_005801.3
XM_017018682.1	4408	Intron			XP_016874171.1
XM_017018683.1	4408	Intron			XP_016874172.1
XM_017018684.1	4408	Intron			XP_016874173.1
XM_017018685.1	4408	Intron			XP_016874174.1

Gene: LINC00612
Gene Name: long intergenic non-protein coding RNA 612

There are no transcripts associated with this gene.

View Full Product Details