Product Details

SNP ID: rs199634350
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6867556 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCAGACACTGACCTTCAGCGCCTCG[A/G]CTCCAGCGCCATGGCGCCCTCCAGG
Phenotype: MIM: 611658 MIM: 190450 MIM: 601447
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC105369632 PubMed Links

Gene Details

Gene: LOC105369632
Gene Name: uncharacterized LOC105369632

There are no transcripts associated with this gene.

Gene: SPSB2
Gene Name: splA/ryanodine receptor domain and SOCS box containing 2

There are no transcripts associated with this gene.

Gene: TPI1
Gene Name: triosephosphate isomerase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000365.5	137	UTR 5			NP_000356.1
NM_001159287.1	137	Missense Mutation	GAC,GGC	D34G	NP_001152759.1
NM_001258026.1	137	Intron			NP_001244955.1

Gene: USP5
Gene Name: ubiquitin specific peptidase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098536.1	137	Intron			NP_001092006.1
NM_003481.2	137	Intron			NP_003472.2

View Full Product Details