Product Details
- SNP ID
-
rs201583543
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:24162249 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GAGTGTGCTGGGATGATACAGCTAA[A/G]ACCATGTTCCGGATTCCCTGGAAAC
- Phenotype
-
MIM: 147574
MIM: 608193
MIM: 612487
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
IRF9
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs10139346] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- IRF9
- Gene Name
- interferon regulatory factor 9
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_006084.4 |
232 |
Silent Mutation |
AAA,AAG |
K35K |
NP_006075.3 |
- Gene
- REC8
- Gene Name
- REC8 meiotic recombination protein
There are no transcripts associated with this gene.
- Gene
- RNF31
- Gene Name
- ring finger protein 31
There are no transcripts associated with this gene.
View Full Product Details