Product Details

SNP ID: rs200293827
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:67658044 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTCCGGTCCTGGGAAAAGGCGGC[C/T]GATTCTTGCAGGGCAACCCTACAAA
Phenotype: MIM: 609377 MIM: 610859 MIM: 607484
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACD PubMed Links

Gene Details

Gene: ACD
Gene Name: adrenocortical dysplasia homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001082486.1	1743	Missense Mutation	CAG,CGG	Q469R	NP_001075955.1
NM_001082487.1	1743	Missense Mutation	CAG,CGG	Q466R	NP_001075956.1
NM_022914.2	1743	Missense Mutation	CAG,CGG	Q466R	NP_075065.2
XM_005256115.3	1743	Missense Mutation	CAG,CGG	Q440R	XP_005256172.1

Gene: C16orf86
Gene Name: chromosome 16 open reading frame 86

There are no transcripts associated with this gene.

Gene: CARMIL2
Gene Name: capping protein regulator and myosin 1 linker 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001013838.1	1743	Intron			NP_001013860.1
NM_001317026.1	1743	Intron			NP_001303955.1
XM_011522874.1	1743	Intron			XP_011521176.1
XM_011522875.2	1743	Intron			XP_011521177.2
XM_017022953.1	1743	Intron			XP_016878442.1

Gene: ENKD1
Gene Name: enkurin domain containing 1

There are no transcripts associated with this gene.

Gene: PARD6A
Gene Name: par-6 family cell polarity regulator alpha

There are no transcripts associated with this gene.

View Full Product Details