Product Details

SNP ID: rs201545927
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:31091294 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTAGACAGAACCAGCGAGAGACACC[A/G]GGGAGCTCAGCAGCATCAGGACAGA
Phenotype: MIM: 610561 MIM: 608547
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: PRSS53 PubMed Links

Gene Details

Gene: PRSS53
Gene Name: protease, serine 53

There are no transcripts associated with this gene.

Gene: VKORC1
Gene Name: vitamin K epoxide reductase complex subunit 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001311311.1	686	Missense Mutation	CCG,CTG	P139L	NP_001298240.1
NM_024006.5	686	Missense Mutation	CCG,CTG	P111L	NP_076869.1
NM_206824.2	686	Silent Mutation	CCC,CCT	P74P	NP_996560.1

Gene: ZNF646
Gene Name: zinc finger protein 646

There are no transcripts associated with this gene.

View Full Product Details