Product Details

SNP ID: rs200962346
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:2151583 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTGTTTCAGAACAAAGTTCTGGA[A/C]GTGGATGGTGTGAAGGTGAAGCTGC
Phenotype: MIM: 605455 MIM: 606692
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: RAB26 PubMed Links

Gene Details

Gene: RAB26
Gene Name: RAB26, member RAS oncogene family

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308053.1	494	Silent Mutation	GAA,GAC	E41D	NP_001294982.1
NM_014353.4	494	Silent Mutation	GAA,GAC	E107D	NP_055168.2
XM_011522448.1	494	Missense Mutation	GAA,GAC	E107D	XP_011520750.1
XM_011522450.2	494	UTR 5			XP_011520752.1

Gene: SNHG19
Gene Name: small nucleolar RNA host gene 19

There are no transcripts associated with this gene.

Gene: SNORD60
Gene Name: small nucleolar RNA, C/D box 60

There are no transcripts associated with this gene.

Gene: TRAF7
Gene Name: TNF receptor associated factor 7

There are no transcripts associated with this gene.

View Full Product Details