Product Details

SNP ID: rs200460971
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:28364470 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCTGGACAGGAGCTATGTCGACAC[A/G]CTGAGGTGCGCTGAGGTGTGCCGCT
Phenotype: MIM: 611519 MIM: 607732 MIM: 610975 MIM: 616815 MIM: 193190
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR4723 PubMed Links

Gene Details

Gene: MIR4723
Gene Name: microRNA 4723

There are no transcripts associated with this gene.

Gene: POLDIP2
Gene Name: DNA polymerase delta interacting protein 2

There are no transcripts associated with this gene.

Gene: SARM1
Gene Name: sterile alpha and TIR motif containing 1

There are no transcripts associated with this gene.

Gene: SEBOX
Gene Name: SEBOX homeobox

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001080837.3	371	Missense Mutation	GCG,GTG	A124V	NP_001074306.3

Gene: TMEM199
Gene Name: transmembrane protein 199

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152464.2	371	Intron			NP_689677.1

Gene: VTN
Gene Name: vitronectin

There are no transcripts associated with this gene.

View Full Product Details