Product Details
- SNP ID
-
rs199891166
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:41041228 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGTCCCACCGGTTGAGAAGCTAGGA[A/C]ATCCACAGAAGCTGGTCTGGCAGCA
- Phenotype
-
MIM: 608819
MIM: 608820
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
KRTAP1-1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs149188249] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRTAP1-1
- Gene Name
- keratin associated protein 1-1
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_030967.2 |
234 |
Missense Mutation |
TGT,TTT |
C57F |
NP_112229.1 |
- Gene
- KRTAP1-3
- Gene Name
- keratin associated protein 1-3
There are no transcripts associated with this gene.
- Gene
- KRTAP2-1
- Gene Name
- keratin associated protein 2-1
There are no transcripts associated with this gene.
View Full Product Details