Product Details

SNP ID
rs199961151
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.17:45137926 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TCATCTCAGCAGGTTTGGACAGAGC[A/G]GCGGGCAGCATCTGGAGGAAAGCGT
Phenotype
MIM: 607328 MIM: 608795
Polymorphism
A/G, Transition substitution
Allele Nomenclature
Literature Links
ACBD4 PubMed Links

Gene Details

Gene
ACBD4
Gene Name
acyl-CoA binding domain containing 4
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001135705.2 1426 Missense Mutation CAG,CGG Q196R NP_001129177.1
NM_001135706.2 1426 Missense Mutation AGC,GGC S209G NP_001129178.1
NM_001135707.2 1426 Missense Mutation AGC,GGC S193G NP_001129179.1
NM_001321352.1 1426 Missense Mutation AGC,GGC S209G NP_001308281.1
NM_001321353.1 1426 Missense Mutation AGC,GGC S209G NP_001308282.1
NM_024722.3 1426 Missense Mutation CAG,CGG Q196R NP_078998.1
XM_006722085.2 1426 Missense Mutation CAG,CGG Q197R XP_006722148.1
XM_011525259.2 1426 Missense Mutation AGC,GGC S209G XP_011523561.1
XM_011525261.2 1426 Missense Mutation CAG,CGG Q196R XP_011523563.1
XM_017025084.1 1426 Missense Mutation AGC,GGC S216G XP_016880573.1
XM_017025085.1 1426 Missense Mutation AGC,GGC S216G XP_016880574.1
XM_017025086.1 1426 Missense Mutation AGC,GGC S216G XP_016880575.1
XM_017025087.1 1426 Missense Mutation AGC,GGC S210G XP_016880576.1
XM_017025088.1 1426 Missense Mutation AGC,GGC S209G XP_016880577.1
XM_017025089.1 1426 Missense Mutation CAG,CGG Q197R XP_016880578.1
XM_017025090.1 1426 Missense Mutation CAG,CGG Q203R XP_016880579.1
XM_017025091.1 1426 Missense Mutation CAG,CGG Q196R XP_016880580.1
XM_017025092.1 1426 Missense Mutation CAG,CGG Q196R XP_016880581.1
XM_017025093.1 1426 Missense Mutation AGC,GGC S216G XP_016880582.1
XM_017025094.1 1426 Missense Mutation AGC,GGC S209G XP_016880583.1
XM_017025095.1 1426 Missense Mutation AGC,GGC S216G XP_016880584.1
XM_017025096.1 1426 Missense Mutation CAG,CGG Q203R XP_016880585.1
XM_017025097.1 1426 Missense Mutation AGC,GGC S209G XP_016880586.1
XM_017025098.1 1426 Missense Mutation AGC,GGC S209G XP_016880587.1
XM_017025099.1 1426 Missense Mutation CAG,CGG Q196R XP_016880588.1
XM_017025100.1 1426 Missense Mutation AGC,GGC S216G XP_016880589.1
XM_017025101.1 1426 Missense Mutation CAG,CGG Q203R XP_016880590.1
Gene
HEXIM1
Gene Name
hexamethylene bisacetamide inducible 1
There are no transcripts associated with this gene.

Gene
PLCD3
Gene Name
phospholipase C delta 3
There are no transcripts associated with this gene.

View Full Product Details