Product Details
- SNP ID
-
rs202207445
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:4953086 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCTGTGGAGAACATCAACAATACT[C/G]TGGGCCCTGCTCTGCTGCAAAAGGC
- Phenotype
-
MIM: 131370
MIM: 176610
MIM: 610431
MIM: 610056
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
ENO3
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs238238] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- ENO3
- Gene Name
- enolase 3
- Gene
- PFN1
- Gene Name
- profilin 1
There are no transcripts associated with this gene.
- Gene
- RNF167
- Gene Name
- ring finger protein 167
There are no transcripts associated with this gene.
- Gene
- SPAG7
- Gene Name
- sperm associated antigen 7
There are no transcripts associated with this gene.
View Full Product Details