Product Details

SNP ID

rs201765310

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.18:50269719 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GTGAGAGACTGACATGGGTTCCAGG[C/T]CATCCTCGTGGGTTCCAGCTCGTGC

Phenotype

MIM: 614759 MIM: 156535

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

CFAP53 PubMed Links

Gene Details

Gene

CFAP53

Gene Name

cilia and flagella associated protein 53

There are no transcripts associated with this gene.

Gene

MBD1

Gene Name

methyl-CpG binding domain protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204136.1	2108	Nonsense Mutation	TGA,TGG	*626W	NP_001191065.1
NM_001204137.1	2108	Intron			NP_001191066.1
NM_001204138.1	2108	Intron			NP_001191067.1
NM_001204139.1	2108	Intron			NP_001191068.1
NM_001204140.1	2108	Intron			NP_001191069.1
NM_001204141.1	2108	Intron			NP_001191070.1
NM_001204142.1	2108	UTR 3			NP_001191071.1
NM_001204143.1	2108	Missense Mutation	GAC,GGC	D522G	NP_001191072.1
NM_001204151.2	2108	UTR 3			NP_001191080.1
NM_001323942.1	2108	Nonsense Mutation	TGA,TGG	*651W	NP_001310871.1
NM_001323947.1	2108	Nonsense Mutation	TGA,TGG	*636W	NP_001310876.1
NM_001323949.1	2108	UTR 3			NP_001310878.1
NM_001323950.1	2108	UTR 3			NP_001310879.1
NM_001323951.1	2108	Intron			NP_001310880.1
NM_001323952.1	2108	UTR 3			NP_001310881.1
NM_001323953.1	2108	Intron			NP_001310882.1
NM_001323954.1	2108	Nonsense Mutation	TGA,TGG	*547W	NP_001310883.1
NM_002384.2	2108	UTR 3			NP_002375.1
NM_015844.2	2108	UTR 3			NP_056669.2
NM_015845.3	2108	Nonsense Mutation	TGA,TGG	*557W	NP_056670.2
NM_015846.3	2108	UTR 3			NP_056671.2
NM_015847.3	2108	UTR 3			NP_056723.2
XM_005258271.2	2108	UTR 3			XP_005258328.1
XM_006722456.2	2108	Missense Mutation	GAC,GGC	D649G	XP_006722519.1
XM_011525991.1	2108	Nonsense Mutation	TGA,TGG	*605W	XP_011524293.1
XM_011525993.2	2108	UTR 3			XP_011524295.1
XM_011525994.2	2108	UTR 3			XP_011524296.1
XM_011525998.2	2108	Intron			XP_011524300.1
XM_011525999.1	2108	Nonsense Mutation	TGA,TGG	*580W	XP_011524301.1
XM_011526001.1	2108	Nonsense Mutation	TGA,TGG	*570W	XP_011524303.1
XM_011526002.1	2108	UTR 3			XP_011524304.1
XM_011526003.2	2108	UTR 3			XP_011524305.1
XM_011526006.1	2108	Missense Mutation	GAC,GGC	D522G	XP_011524308.1
XM_011526007.1	2108	UTR 3			XP_011524309.1
XM_017025751.1	2108	Missense Mutation	GAC,GGC	D634G	XP_016881240.1
XM_017025752.1	2108	Nonsense Mutation	TGA,TGG	*611W	XP_016881241.1
XM_017025753.1	2108	Missense Mutation	GAC,GGC	D624G	XP_016881242.1
XM_017025754.1	2108	Intron			XP_016881243.1
XM_017025755.1	2108	Intron			XP_016881244.1
XM_017025756.1	2108	Missense Mutation	GAC,GGC	D603G	XP_016881245.1
XM_017025757.1	2108	UTR 3			XP_016881246.1
XM_017025758.1	2108	UTR 3			XP_016881247.1
XM_017025759.1	2108	UTR 3			XP_016881248.1
XM_017025760.1	2108	UTR 3			XP_016881249.1
XM_017025761.1	2108	Intron			XP_016881250.1
XM_017025762.1	2108	UTR 3			XP_016881251.1
XM_017025763.1	2108	UTR 3			XP_016881252.1
XM_017025764.1	2108	UTR 3			XP_016881253.1
XM_017025765.1	2108	Missense Mutation	GAC,GGC	D568G	XP_016881254.1
XM_017025766.1	2108	UTR 3			XP_016881255.1
XM_017025767.1	2108	UTR 3			XP_016881256.1
XM_017025768.1	2108	Intron			XP_016881257.1
XM_017025769.1	2108	UTR 3			XP_016881258.1
XM_017025770.1	2108	UTR 3			XP_016881259.1
XM_017025771.1	2108	UTR 3			XP_016881260.1
XM_017025772.1	2108	Intron			XP_016881261.1
XM_017025773.1	2108	UTR 3			XP_016881262.1
XM_017025774.1	2108	UTR 3			XP_016881263.1
XM_017025775.1	2108	Intron			XP_016881264.1
XM_017025776.1	2108	UTR 3			XP_016881265.1
XM_017025777.1	2108	Intron			XP_016881266.1

View Full Product Details