Product Details

SNP ID: rs200063072
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:39839120 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACCTTAGCCCCCGGTTTGATGTGG[A/T]TCTGGTCCACACCACCCAGGATTGC
Phenotype: MIM: 604556 MIM: 134795
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: DYRK1B PubMed Links

Gene Details

Gene: DYRK1B
Gene Name: dual specificity tyrosine phosphorylation regulated kinase 1B

There are no transcripts associated with this gene.

Gene: FBL
Gene Name: fibrillarin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001436.3	359	Missense Mutation	AAC,ATC	N155I	NP_001427.2
XM_005258651.2	359	Missense Mutation	AAC,ATC	N154I	XP_005258708.1
XM_011526623.2	359	Missense Mutation	AAC,ATC	N98I	XP_011524925.1

Gene: MIR6719
Gene Name: microRNA 6719

There are no transcripts associated with this gene.

View Full Product Details