Product Details

SNP ID: rs200990353
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49003313 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCACATCCGGGGACTGGGGCTGGA[C/T]GATGCCTTGGAGCCTCGGCAGGTAG
Phenotype: MIM: 138570 MIM: 604788
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GYS1 PubMed Links

Gene Details

Gene: GYS1
Gene Name: glycogen synthase 1

There are no transcripts associated with this gene.

Gene: MIR6798
Gene Name: microRNA 6798

There are no transcripts associated with this gene.

Gene: RUVBL2
Gene Name: RuvB like AAA ATPase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321190.1	566	UTR 5			NP_001308119.1
NM_001321191.1	566	UTR 5			NP_001308120.1
NM_006666.2	566	Silent Mutation	GAC,GAT	D34D	NP_006657.1
XM_011526330.1	566	UTR 5			XP_011524632.1

View Full Product Details