Product Details

SNP ID: rs200595917
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:11426258 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAACCAAGGTCTCCTCTAGGTACTG[A/C]AGCTGGTTCTGGAGGGCGGGCAGGG
Phenotype: MIM: 615956 MIM: 177060 MIM: 616743
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CCDC151 PubMed Links

Gene Details

Gene: CCDC151
Gene Name: coiled-coil domain containing 151

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001302453.1	990	Silent Mutation	CTG,CTT	L229L	NP_001289382.1
NM_001302454.1	990	Silent Mutation	CTG,CTT	L223L	NP_001289383.1
NM_145045.4	990	Silent Mutation	CTG,CTT	L283L	NP_659482.3
XM_017026241.1	990	Silent Mutation	CTG,CTT	L283L	XP_016881730.1

Gene: PRKCSH
Gene Name: protein kinase C substrate 80K-H

There are no transcripts associated with this gene.

Gene: RGL3
Gene Name: ral guanine nucleotide dissociation stimulator like 3

There are no transcripts associated with this gene.

View Full Product Details