Product Details

SNP ID: rs201331063
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35140116 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGGCCACATCTTGGTTTTCTGTGTG[A/G]GTCTCCTCACCATGGCCAAGGCAGG
Phenotype: MIM: 602359 MIM: 606684 MIM: 608303
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FXYD1 PubMed Links

Gene Details

Gene: FXYD1
Gene Name: FXYD domain containing ion transport regulator 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278717.1	126	Missense Mutation	AGT,GGT	S13G	NP_001265646.1
NM_001278718.1	126	Missense Mutation	AGT,GGT	S13G	NP_001265647.1
NM_005031.4	126	Missense Mutation	AGT,GGT	S13G	NP_005022.2
NM_021902.3	126	Missense Mutation	AGT,GGT	S13G	NP_068702.1
XM_017026874.1	126	Missense Mutation	AGT,GGT	S13G	XP_016882363.1
XM_017026875.1	126	Missense Mutation	AGT,GGT	S31G	XP_016882364.1
XM_017026876.1	126	Missense Mutation	AGT,GGT	S31G	XP_016882365.1

Gene: FXYD7
Gene Name: FXYD domain containing ion transport regulator 7

There are no transcripts associated with this gene.

Gene: LGI4
Gene Name: leucine rich repeat LGI family member 4

There are no transcripts associated with this gene.

View Full Product Details