Product Details

SNP ID: rs201766055
Assay Type: Functionally tested
NCBI dbSNP Submissions: 12
Location: Chr.1:46673325 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCCCCACCCTTGTGCAACCTACCC[C/G]CCCTGCTGAACCACTCTGTCTCCTA
Phenotype: MIM: 608917
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ATPAF1 PubMed Links

Gene Details

Gene: ATPAF1
Gene Name: ATP synthase mitochondrial F1 complex assembly factor 1

There are no transcripts associated with this gene.

Gene: EFCAB14
Gene Name: EF-hand calcium binding domain 14

There are no transcripts associated with this gene.

Gene: EFCAB14-AS1
Gene Name: EFCAB14 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TEX38
Gene Name: testis expressed 38

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145474.3	592	Missense Mutation	CCC,GCC	P164A	NP_001138946.1
NM_001300863.1	592	Missense Mutation	CCC,GCC	P110A	NP_001287792.1
NM_001300864.1	592	Missense Mutation	CCC,GCC	P88A	NP_001287793.1
XM_011541421.2	592	Missense Mutation	CCC,GCC	P165A	XP_011539723.1

View Full Product Details