Product Details

SNP ID: rs201013021
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:155248114 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTTTCCTGGATATCTGGAGGAAA[A/C]GAGTGACCAGGCCCCGACCTGGCCA
Phenotype: MIM: 606463 MIM: 606913
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: FAM189B PubMed Links

Gene Details

Gene: FAM189B
Gene Name: family with sequence similarity 189 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267608.1	2375	Missense Mutation			NP_001254537.1
NM_006589.2	2375	Missense Mutation			NP_006580.2
NM_198264.1	2375	Missense Mutation			NP_937995.1
XM_005244845.1	2375	Missense Mutation			XP_005244902.1

Gene: GBA
Gene Name: glucosylceramidase beta

There are no transcripts associated with this gene.

Gene: SCAMP3
Gene Name: secretory carrier membrane protein 3

There are no transcripts associated with this gene.

View Full Product Details