Product Details

SNP ID

rs200443495

Assay Type

Functionally tested

NCBI dbSNP Submissions

4

Location

Chr.1:109280906 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ACACTCCGGCTGGTGAGTGGCATTC[A/G]GCTGGCAGGCCTGGGGATGGCCGAG

Phenotype

MIM: 604265 MIM: 613126

Polymorphism

A/G, Transition substitution

Allele Nomenclature

Literature Links

CELSR2 PubMed Links

Gene Details

Gene

CELSR2

Gene Name

cadherin EGF LAG seven-pass G-type receptor 2

There are no transcripts associated with this gene.

Gene

PSRC1

Gene Name

proline and serine rich coiled-coil 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001005290.3	1004	Missense Mutation	CCG,CTG	P225L	NP_001005290.1
NM_001032291.2	1004	Nonsense Mutation	CGA,TGA	R259*	NP_001027462.1
NM_032636.7	1004	Nonsense Mutation	CGA,TGA	R259*	NP_116025.1
XM_005271283.2	1004	Nonsense Mutation	CGA,TGA	R259*	XP_005271340.1
XM_011542306.2	1004	Nonsense Mutation	CGA,TGA	R243*	XP_011540608.1
XM_017002560.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858049.1
XM_017002561.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858050.1
XM_017002562.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858051.1
XM_017002563.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858052.1
XM_017002564.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858053.1
XM_017002565.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858054.1
XM_017002566.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858055.1
XM_017002567.1	1004	Nonsense Mutation	CGA,TGA	R289*	XP_016858056.1
XM_017002568.1	1004	Nonsense Mutation	CGA,TGA	R259*	XP_016858057.1
XM_017002569.1	1004	Nonsense Mutation	CGA,TGA	R259*	XP_016858058.1
XM_017002570.1	1004	Nonsense Mutation	CGA,TGA	R259*	XP_016858059.1
XM_017002571.1	1004	Nonsense Mutation	CGA,TGA	R243*	XP_016858060.1
XM_017002572.1	1004	Nonsense Mutation	CGA,TGA	R243*	XP_016858061.1
XM_017002573.1	1004	Nonsense Mutation	CGA,TGA	R243*	XP_016858062.1
XM_017002574.1	1004	Nonsense Mutation	CGA,TGA	R243*	XP_016858063.1
XM_017002575.1	1004	Nonsense Mutation	CGA,TGA	R243*	XP_016858064.1
XM_017002576.1	1004	Missense Mutation	CCG,CTG	P225L	XP_016858065.1
XM_017002577.1	1004	Missense Mutation	CCG,CTG	P225L	XP_016858066.1

View Full Product Details