Product Details
- SNP ID
-
rs199844882
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:93585260 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCAGGGCCCGCCCGGTTCGGGCCA[C/G]AGCCAGCAGCACATCGAGTGCGTGG
- Phenotype
-
MIM: 132890
- Polymorphism
- C/G, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
NR2F1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs557800691] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- NR2F1
- Gene Name
- nuclear receptor subfamily 2 group F member 1
- Gene
- NR2F1-AS1
- Gene Name
- NR2F1 antisense RNA 1
There are no transcripts associated with this gene.
View Full Product Details