Product Details

SNP ID: rs201393795
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31720151 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGGCTCCAGGCGGCAGGACTGCCG[A/G]TCCACACAGCCCAGCACAGGGACCT
Phenotype: MIM: 606520 MIM: 604744 MIM: 610435 MIM: 606038 MIM: 610437 MIM: 611404
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C6orf25 PubMed Links

Gene Details

Gene: C6orf25
Gene Name: chromosome 6 open reading frame 25

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025260.3	160	Intron			NP_079536.2
NM_138272.2	160	Intron			NP_612116.1
NM_138273.2	160	Intron			NP_612117.1
NM_138274.2	160	Intron			NP_612118.1
NM_138275.2	160	Intron			NP_612119.1
NM_138277.2	160	Intron			NP_612121.1
XM_011514920.2	160	Intron			XP_011513222.1
XM_011514921.2	160	Intron			XP_011513223.1
XM_017011330.1	160	Intron			XP_016866819.1
XM_017011331.1	160	Intron			XP_016866820.1
XM_017011332.1	160	Intron			XP_016866821.1
XM_017011333.1	160	Intron			XP_016866822.1

Gene: DDAH2
Gene Name: dimethylarginine dimethylaminohydrolase 2

There are no transcripts associated with this gene.

Gene: LY6G6C
Gene Name: lymphocyte antigen 6 complex, locus G6C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025261.2	160	Silent Mutation	GAC,GAT	D35D	NP_079537.1

Gene: LY6G6D
Gene Name: lymphocyte antigen 6 complex, locus G6D

There are no transcripts associated with this gene.

Gene: LY6G6E
Gene Name: lymphocyte antigen 6 complex, locus G6E (pseudogene)

There are no transcripts associated with this gene.

Gene: LY6G6F
Gene Name: lymphocyte antigen 6 complex, locus G6F

There are no transcripts associated with this gene.

View Full Product Details