Product Details

SNP ID: hCV191748886
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.7:73865689 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCCTGGCACCTGGCCTATCTCATCA[C/T]CTGGACCACCTGCCTGGCCTCCCAC
Phenotype: MIM: 612547
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: WBSCR28 PubMed Links
Additional Information: For this assay, SNP(s) [rs1136647] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.