Product Details

SNP ID: rs200776122
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.9:2804331 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCATCTTGCTCTTAACTCTTTCCAC[C/G]TATGTGCTCAGTTTTTCAAGTAGAA
Phenotype: MIM: 609960
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: PUM3 PubMed Links
Additional Information: For this assay, SNP(s) [rs12171] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

There are no transcripts associated with this gene.