Product Details

SNP ID: rs13823
Assay Type: Functionally tested
NCBI dbSNP Submissions: 44
Location: Chr.1:162374279 on Build GRCh38
Set Membership: HapMap JSNP
Context Sequence [VIC/FAM]: TGGGGTACATGCGGCAGCAGGCCAC[A/G]CACTTGTAGCCATTCTGCTGTGCTG
Phenotype: MIM: 605551
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C1orf111 PubMed Links

Gene Details

Gene: C1orf111
Gene Name: chromosome 1 open reading frame 111

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182581.3	619	Silent Mutation	TGC,TGT	C185C	NP_872387.2
XM_005245103.3	619	Silent Mutation	TGC,TGT	C147C	XP_005245160.1
XM_011509443.2	619	Silent Mutation	TGC,TGT	C204C	XP_011507745.1
XM_011509444.1	619	Silent Mutation	TGC,TGT	C135C	XP_011507746.1
XM_011509445.2	619	Intron			XP_011507747.1

Gene: C1orf226
Gene Name: chromosome 1 open reading frame 226

There are no transcripts associated with this gene.

Gene: NOS1AP
Gene Name: nitric oxide synthase 1 adaptor protein

There are no transcripts associated with this gene.

View Full Product Details