Product Details

SNP ID: rs17423
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:154401322 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTTGTTCTCACCCATCTGGTTTGG[C/T]CATTCCTCCTTGGTGGGAATCATCC
Phenotype: MIM: 300081 MIM: 312173
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DNASE1L1 PubMed Links

Gene Details

Gene: DNASE1L1
Gene Name: deoxyribonuclease I-like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001009932.2	2925	UTR 3			NP_001009932.1
NM_001009933.2	2925	UTR 3			NP_001009933.1
NM_001009934.2	2925	UTR 3			NP_001009934.1
NM_001303620.1	2925	UTR 3			NP_001290549.1
NM_006730.3	2925	UTR 3			NP_006721.1
XM_005277829.4	2925	UTR 3			XP_005277886.1
XM_011531122.2	2925	UTR 3			XP_011529424.1
XM_017029332.1	2925	UTR 3			XP_016884821.1

Gene: LOC107987332
Gene Name: uncharacterized LOC107987332

There are no transcripts associated with this gene.

Gene: RPL10
Gene Name: ribosomal protein L10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256577.2	2925	UTR 3			NP_001243506.2
NM_001256580.2	2925	UTR 3			NP_001243509.2
NM_001303624.1	2925	UTR 3			NP_001290553.1
NM_001303625.1	2925	UTR 3			NP_001290554.1
NM_001303626.1	2925	UTR 3			NP_001290555.1
NM_006013.4	2925	UTR 3			NP_006004.3

Gene: SNORA70
Gene Name: small nucleolar RNA, H/ACA box 70

There are no transcripts associated with this gene.

View Full Product Details