Product Details

SNP ID: rs11516
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:53064321 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCAGAGTAGGATCACATGAATAGGG[A/G]AAAAAAGAGAGTCTATTTTTGTCTA
Phenotype: MIM: 607717
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LOC283335 PubMed Links

Gene Details

Gene: LOC283335
Gene Name: uncharacterized LOC283335

There are no transcripts associated with this gene.

Gene: MIR6757
Gene Name: microRNA 6757

There are no transcripts associated with this gene.

Gene: SPRYD3
Gene Name: SPRY domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_032840.2	4722	UTR 3			NP_116229.1

Gene: TNS2
Gene Name: tensin 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015319.2	4722	UTR 3			NP_056134.2
NM_170754.2	4722	UTR 3			NP_736610.2
NM_198316.1	4722	UTR 3			NP_938072.1
XM_006719302.3	4722	UTR 3			XP_006719365.1
XM_006719303.1	4722	UTR 3			XP_006719366.1
XM_011538079.1	4722	UTR 3			XP_011536381.1
XM_017019088.1	4722	UTR 3			XP_016874577.1
XM_017019089.1	4722	UTR 3			XP_016874578.1

View Full Product Details