Product Details

SNP ID: rs2069510
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57748481 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGATTGCCCTCTCAGTGTCCAGAAG[C/G]GAAATGGCAGCTTTTCTTCCTTCCA
Phenotype: MIM: 605476 MIM: 123829 MIM: 613336 MIM: 181035
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: AGAP2 PubMed Links

Gene Details

Gene: AGAP2
Gene Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2

There are no transcripts associated with this gene.

Gene: CDK4
Gene Name: cyclin dependent kinase 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000075.3	1248	UTR 3			NP_000066.1

Gene: MARCH9
Gene Name: membrane associated ring-CH-type finger 9

There are no transcripts associated with this gene.

Gene: MIR6759
Gene Name: microRNA 6759

There are no transcripts associated with this gene.

Gene: TSPAN31
Gene Name: tetraspanin 31

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005981.3	1248	Intron			NP_005972.1
XM_005269074.3	1248	Intron			XP_005269131.2
XM_017019793.1	1248	Intron			XP_016875282.1

View Full Product Details