Product Details

SNP ID: rs2282090
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:104314292 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTTGGCTTCCTGGCAGGCTGAGCA[C/T]GGCTCCCACGAAAGCCCGCCTTGTC
Phenotype: MIM: 612314
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GSTO2 PubMed Links

Gene Details

Gene: GSTO2
Gene Name: glutathione S-transferase omega 2

There are no transcripts associated with this gene.

Gene: ITPRIP
Gene Name: inositol 1,4,5-trisphosphate receptor interacting protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001272012.1	1901	UTR 3			NP_001258941.1
NM_001272013.1	1901	UTR 3			NP_001258942.1
NM_033397.3	1901	UTR 3			NP_203755.1
XM_005270257.2	1901	UTR 3			XP_005270314.1

Gene: LOC101927472
Gene Name: uncharacterized LOC101927472

There are no transcripts associated with this gene.

View Full Product Details