Product Details

SNP ID: rs2728728
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:154781040 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTCTGGTTTGTTTTGTCCCTGTTAG[C/G]TAGCATGGGCACTGGCCTAGCTAGT
Phenotype: MIM: 300126 MIM: 305360
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DKC1 PubMed Links

Gene Details

Gene: DKC1
Gene Name: dyskerin pseudouridine synthase 1

There are no transcripts associated with this gene.

Gene: MPP1
Gene Name: membrane palmitoylated protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001166460.1		Intron			NP_001159932.1
NM_001166461.1		Intron			NP_001159933.1
NM_001166462.1		Intron			NP_001159934.1
NM_002436.3		Intron			NP_002427.1
XM_011531167.1		Intron			XP_011529469.1
XM_011531169.1		Intron			XP_011529471.1

Gene: SNORA56
Gene Name: small nucleolar RNA, H/ACA box 56

There are no transcripts associated with this gene.

View Full Product Details