Product Details

SNP ID: rs2233477
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.3:50350831 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: ACTCAGAGGCGTGGCTGGGGCGGGG[A/G]ACGGCTCGTCCCAGGAAGTCCTGGG
Phenotype: MIM: 607068 MIM: 607072 MIM: 605082 MIM: 607069 MIM: 607070
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CYB561D2 PubMed Links

Gene Details

Gene: CYB561D2
Gene Name: cytochrome b561 family member D2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291284.1	225	UTR 5			NP_001278213.1
NM_007022.4	225	UTR 5			NP_008953.1

Gene: NPRL2
Gene Name: NPR2-like, GATOR1 complex subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006545.4	225	UTR 5			NP_006536.3
XM_005264808.4	225	Intron			XP_005264865.1
XM_011533288.2	225	Intron			XP_011531590.1
XM_017005555.1	225	Intron			XP_016861044.1
XM_017005556.1	225	Intron			XP_016861045.1

Gene: RASSF1
Gene Name: Ras association domain family member 1

There are no transcripts associated with this gene.

Gene: TMEM115
Gene Name: transmembrane protein 115

There are no transcripts associated with this gene.

Gene: ZMYND10
Gene Name: zinc finger MYND-type containing 10

There are no transcripts associated with this gene.

View Full Product Details