Product Details

SNP ID: rs2292307
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.10:73790158 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCCCCTATCTCTAGATGACTGACTG[A/C]CTGTCATCCTCAGACCCCACAGCAG
Phenotype: MIM: 608842 MIM: 616932
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CHCHD1 PubMed Links

Gene Details

Gene: CHCHD1
Gene Name: coiled-coil-helix-coiled-coil-helix domain containing 1

There are no transcripts associated with this gene.

Gene: FUT11
Gene Name: fucosyltransferase 11

There are no transcripts associated with this gene.

Gene: ZSWIM8
Gene Name: zinc finger SWIM-type containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242487.1		Intron			NP_001229416.1
NM_001242488.1		Intron			NP_001229417.1
NM_015037.3		Intron			NP_055852.2
XM_005269648.2		Intron			XP_005269705.1
XM_005269653.3		Intron			XP_005269710.1
XM_005269655.3		Intron			XP_005269712.1
XM_006717725.3		Intron			XP_006717788.1
XM_011539544.1		Intron			XP_011537846.1
XM_017015978.1		Intron			XP_016871467.1

Gene: ZSWIM8-AS1
Gene Name: ZSWIM8 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details