Product Details

SNP ID: rs3087776
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:63432917 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAGAAGAGTCGTCAGGTTTGGAAA[C/T]TGTATATTAAGCCCTTCACTGAAGT
Phenotype: MIM: 600019 MIM: 615047
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYB561 PubMed Links

Gene Details

Gene: CYB561
Gene Name: cytochrome b561

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001017916.1	2413	UTR 3			NP_001017916.1
NM_001017917.1	2413	UTR 3			NP_001017917.1
NM_001915.3	2413	UTR 3			NP_001906.3
XM_005257091.1	2413	UTR 3			XP_005257148.1
XM_017024260.1	2413	UTR 3			XP_016879749.1
XM_017024261.1	2413	UTR 3			XP_016879750.1
XM_017024262.1	2413	UTR 3			XP_016879751.1

Gene: TANC2
Gene Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2

There are no transcripts associated with this gene.

View Full Product Details