Product Details

SNP ID: rs2143346
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:26198221 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AACACTGACAAACATTAACTTCTCT[C/G]CTGTATGTCTCAGGCCTTTTAACAG
Phenotype: MIM: 602792 MIM: 602804 MIM: 602811 MIM: 602823 MIM: 602830
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HIST1H2AD PubMed Links

Gene Details

Gene: HIST1H2AD
Gene Name: histone cluster 1, H2ad

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021065.3		Intron			NP_066409.1

Gene: HIST1H2BF
Gene Name: histone cluster 1, H2bf

There are no transcripts associated with this gene.

Gene: HIST1H3D
Gene Name: histone cluster 1, H3d

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003530.4		Intron			NP_003521.2

Gene: HIST1H4D
Gene Name: histone cluster 1, H4d

There are no transcripts associated with this gene.

Gene: HIST1H4E
Gene Name: histone cluster 1, H4e

There are no transcripts associated with this gene.

View Full Product Details