Product Details

SNP ID: rs2123157
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:82995189 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGAAAATAAGGATGGAAGTAGAGA[T/C]CCCTTGACTTGTGCACATTCTGGGA
Phenotype: MIM: 614547 MIM: 604799
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: C15orf40 PubMed Links

Gene Details

Gene: C15orf40
Gene Name: chromosome 15 open reading frame 40

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001160113.1	1253	Intron			NP_001153585.1
NM_001160114.1	1253	Intron			NP_001153586.1
NM_001160115.1	1253	Intron			NP_001153587.1
NM_001160116.1	1253	Intron			NP_001153588.1
NM_144597.2	1253	Intron			NP_653198.2
XM_006720385.2	1253	UTR 3			XP_006720448.1
XM_011521212.2	1253	UTR 3			XP_011519514.1
XM_011521213.2	1253	Intron			XP_011519515.1
XM_011521214.2	1253	Intron			XP_011519516.1

Gene: FAM103A1
Gene Name: family with sequence similarity 103 member A1

There are no transcripts associated with this gene.

Gene: HOMER2
Gene Name: homer scaffolding protein 2

There are no transcripts associated with this gene.

View Full Product Details